genetics, disability, age, or veteran status.
-IBM has a long history of commitment to Diversity and has consistently taken the lead on Diversity policies long before it was required by law.
-The Focus on eliminating barriers, and understanding regional constituencies and differences between the constituencies.
-Adapted workplace to be more flexible and began focus on work-life integration.
Piaget 인지발달이론 기본 개념
Piaget(1896~1980)
스위스
1918년 생물학 박사
생물학+철학(인식론)
파리의 비네 연구소에서 어린이의 지능검사 중 왜 틀리게 답하는가 ?
발생적 인식론
Genetic Epistemology
몸의 발달 → 지식 발달
발달단계 4단계
인지구조(schema)
적응(adaptation)
동화(assimilation)
adaptional process)이다. 이 적응과정은 두 개의 하위과정으로 나누어지는데, 그것이 곧 同化와 調節(accommodation)이다. 피아제는 그가 공부한 생물학적 기초에서 인간의 적응능력들의 성숙을 인지발달로 보았고, 적응과정은 곧 이 두 가지 하위개념으로 설명될 수 있다고 생각했다.
同化(Assimilation)란 인간이
algorithms to optimize operations and improve overall performance.
4차 산업혁명의 핵심 특징 중 하나는 사물인터넷(IoT), 빅데이터, 인공지능(AI) 등의 기술을 융합해 지능화된 시스템을 만드는 것이다. 유비쿼터스 컴퓨팅은 이러한 기술이 서로 그리고 물리적 환경과 상호 작용할 수 있는 플랫폼을 제공함으로써 중요
adapt to them. Even
this optimisation sequence that takes into account uncertainty in supply and demand is
based on ceteris paribus, and can be disrupted by the emergence of new products,
markets, competitors, business models, as well as new environment, health and
governance mandates. Such adversarial in uences can throw off even the best-laid plan,
hence they require an immediate response to th
adapt to the fast-changing environment. If a person is to perform data gathering and analysis for every change in data, it would be impossible for him to complete the task because the data is endlessly generated in this era of big data. What would be the amount of data trails that people visiting Amazon’s web page leave every day? Uncountable. The machine learning is a must in such a business e
sequence
NNTCAAGTTTTATGATTTATTTAACTTGTGGAACAAAAATAAACCAGATTAACCACAACCATGCCTTACTTTATCAAATGTATAAGANGTAAATATGAATCTTATATGACAAAATGTTTCATTCATTATAACAAATTTCCAATAATCCTGTCAATNATATTTCTAAATTTTCCCCCAAATTCTAAGCAGAGTATGTAAATTGGAAGTTAACTTATGCACGCTTAACTATCTTAACAAGCTTTGAGTGCAAGAGATTGANGAGTTCAAATCTGACCAAGATGTTGATGTTGGATAAGAGAATTCTCTGCTCCCCACCTCTANGTTGCCAGCCCTC
(Picture adapted from P. Cooper’s NCBI field guide)
value, gap of hip girth and waist girth. (N: Normal type, A: Small breast and big hip, H: Big breast and small hip). These basic data for garment size specification could be usefully adapted for the apparel companies' own sizing system according to their age targets and body shapes, to achieve efficient production and better fit. It also could be applied to furniture, automobile packaging, etc.
아티팩트 (interlace artifacts)가 발생한 부분만의 필드를 제거하는 방법을 사용하는 경우가 많은데 이러한 방법을 Adaptive De-interlacing이라고 한다. 필드들을 인식하여 하는 경우를 Field Adaptive De-interlacing, 모션을 인식하여 하는 경우를 Motion Adaptive De-interlacing이라고 하는데 대부분 상당히 고가이다.
아티팩트 (interlace artifacts)가 발생한 부분만의 필드를 제거하는 방법을 사용하는 경우가 많은데 이러한 방법을 Adaptive De-interlacing이라고 한다. 필드들을 인식하여 하는 경우를 Field Adaptive De-interlacing, 모션을 인식하여 하는 경우를 Motion Adaptive De-interlacing이라고 하는데 대부분 상당히 고가이다.