What is MirrorPop?
◎ MirrorPop(MV800) is the compact digital camera that was released september 2011 from Samsung
◎ MirrorPop’s main concept is “See a love between 0˚~180˚”
(0도에서 180도 사이에서 사랑을 보다.)
⇒ MirrorPop’s LCD can monitor wide angle
◎ MirrorPop has Various applications such as 3D Picture App, Funny Face, Self Camera Posing Guide
⇒ S
Site), 전자 프로그램 가이드(Electronic Programme Guide, EPG), 슬라이드 쇼(Slide Show, SS), 동적 레이블 서비스(Dynamic Label Service, DLS), MPEG-4 BIFS(BInary Formatf or Scenes)와 같은 서비스들이 가능하다. 지상파 DMB는 이동 중(최대 200km/h)에도 CD급 고품질의 라디오, TV 동영상 및 데이터 방송을 수신할 수 있도록 만들어졌다.
등 다양한 방송매체간의 경쟁이 과거 어느 때보다도 심화
인터넷이나 온라인 PC통신과 같은 정보제공업체, 전화사업자 등과의 이종매체간의 경쟁도 본격화
.
.
.
• DMB (Digital Multimedia Broadcasting)
: 방송과 통신이 결합된 차세대
이동 멀티미디어 방송 서비스. `손 안의 TV`
.
.
.
(중략)
The first problem is SKT need more comprehensive CSR strategy to guide the cross-functional teams managing CSR and the other is that SKT Corporate Citizenship Committee would provide a platform for cross-functional communication and integration of strategy. As for these two issues, should recommend to the CEO to re-organize the CSR team or was it a better solution to create a new CSR strategy?
guide drivers to their proper destination. Nexus one support a quite interesting feature, voice recognition. You don't have to type your destination. You just speak and then, it will find you destination automatically. Its navigation system is user friendly. For example, thanks to satellite system, it can find heavy traffic area and find alternative routes very fast.
2. Gmail: Google developed t
Digital Osilloscope
③ Function generator
¨ê Pulser & Receiver
¨ë High power UT system(Ram-1000)
2) 두께측정실험( A-Scan)
¨ç Calibration
- 실험에 사용할 Transducer의 주파수를 확인하는 과정.
- Oscilloscope 상에 나타나는 파형의 한 주기를 측정하여 주파수를 구한다. F = 1/t
¨è 속도측정
- 초음파의
PVR소개
WHAT IS PVR ?
Personal Video Recorder
개인용 비디오 녹화기
DVR (Digital Video Recorder) –보안용 CCTV
HDR (Hard Disk Recorder) – 가정용 하드디스크 녹화기
HDR + EPG(Electronic Program Guide)
개인화 및 시청 편의성 극대화
하드디스크를 이용한 녹화, 재생 및 시간차 재생 등 (HDR 기능) + 예약녹화, 시리즈녹화,
Preface
You can be the best palace tour guide for your family, friends, and tourists with this!
This book is the culmination of five years of research, field study, and personal experience on the subject of Changdeokgung Palace. While working as a tour guide at the royal palace, I gave many tours for locals and global tourists and met lots of people who were interested in Korean royal palac
sequence
NNTCAAGTTTTATGATTTATTTAACTTGTGGAACAAAAATAAACCAGATTAACCACAACCATGCCTTACTTTATCAAATGTATAAGANGTAAATATGAATCTTATATGACAAAATGTTTCATTCATTATAACAAATTTCCAATAATCCTGTCAATNATATTTCTAAATTTTCCCCCAAATTCTAAGCAGAGTATGTAAATTGGAAGTTAACTTATGCACGCTTAACTATCTTAACAAGCTTTGAGTGCAAGAGATTGANGAGTTCAAATCTGACCAAGATGTTGATGTTGGATAAGAGAATTCTCTGCTCCCCACCTCTANGTTGCCAGCCCTC
(Picture adapted from P. Cooper’s NCBI field guide)
of microscopy that forms images of surfaces using a physical probe
the interaction between end of the tip and surface of sample
not only the images of surface of sample but also the various physical properties of sample
The components of SPM
Probe
optical mechanic part to detect interactions
three-dimensional nano scanner part
digital electronic control part
software part