majority 대다수
make a profit 이익을 얻다
Manager 과장
Mamaging Director 상무
management 경영, 관리 (the ∼)
(집학적) 경영진
manifest 명백한
manpower 인적자원(=human
resources) 유효 총인원
manual 안내서, 소책자margin 여백,
가장자리, 한계, 수익, 마진
marginal 가장자리의,한계의,최저의
marginally 최소한으로
marketa
consensus, then hell, lets vote.
Suits me! Im votin for yours truly.
Well, Im votin for yours truly, too.
OK. Im with you fellas.
- Mind if we join you, old-timer?
Join me, mson. Join me.
You work for the railroad, grandpa?
I work for no man.
- Got a name, do you? - I have no name.
That may be why you had difficulty finding gainful employment.
Ysee, in the mart of competitive commerce...
You seek
sequence
NNTCAAGTTTTATGATTTATTTAACTTGTGGAACAAAAATAAACCAGATTAACCACAACCATGCCTTACTTTATCAAATGTATAAGANGTAAATATGAATCTTATATGACAAAATGTTTCATTCATTATAACAAATTTCCAATAATCCTGTCAATNATATTTCTAAATTTTCCCCCAAATTCTAAGCAGAGTATGTAAATTGGAAGTTAACTTATGCACGCTTAACTATCTTAACAAGCTTTGAGTGCAAGAGATTGANGAGTTCAAATCTGACCAAGATGTTGATGTTGGATAAGAGAATTCTCTGCTCCCCACCTCTANGTTGCCAGCCCTC
(Picture adapted from P. Cooper’s NCBI field guide)
do not have enough courage to do so. High rank managers do not see much needs to move since they have adapted to the culture for a long period time and have stable status founded in the company. They rather do not take the risk. Despite the frustrating 30% of turnover rate, Mr. Baek does not seek it as something negative. He just accepts the fact as a natural feature of the industry. Employees
bound to be curious.
Shed be on her back...
...before youd unwrapped the first bunch of flowers.
Any one of a dozen men could manage it.
I have my reputation to think of.
I can see Im going to have to tell you everything.
-Of course you are. -Yes.
My aunt is not on her own just at the moment.
She has a young friend staying with her.
Y:i Madame de Tourvel.
You cant mean it.
To seduce a woman famou
bound to have personality conflicts. In many cases, personality conflicts can lead to one of the feuding parties leaving the company. But if the conflict involves two tenured employees, the business might be seriously affected, even destroyed. Despite the uncertainty it brings to workers lives, the company must look out for its own best interests first and not allow this disastrous situation to o
consensual contract)이다.
10.1.2 무역계약의 체결절차
무역계약을 체결하기에 앞서 해외시장조사를 통하여 목적시장을 결정하고, 그 시장에서의 신용 있고 유력한 거래처를 선정한 다음 그 거래처에 대하여 거래를 제의하는 거래제의장(circular letter)을 발송한다.
그리고 이와 같은 거래제의에 상대방이 응
grade on this paper.
Support: You have several sentence fragments and subject- verb agreement errors in your paper.
Warrant: These types of errors result in a failing grade in college papers.
(1) Warrants vary depending on what people commonly believe, value, want
⇒ especially values, beliefs, and training vary from culture to culture
⇒ so warrants are also culture-bound
Consensus(일치성)
* Response is the same as others to same situation
(다른 사람들도 같은 상황에 대해서 똑같이 반응하는가)
Consistency(일관성)
* Responds in the same way over time
(시간이 지나도 같은 방식으로 반응하는가)
The tendency to underestimate the influence of external factors and overestimate the influence