SEM?
Scanning electron microscope
To analysis surface of specimen
Qualitative analysis at certain point
Operation principal of SEM
Emission electron from filament
Accelerate electron by electric field
Focusing electron by lens → mono-chromatic electron beam
Generate secondary electron and etc.
Detection of electron
electromagnetic wave
i. Patent: Method for purificating carbon nanotube and electromagnetic wave absorption material to include carbon nanotube that fabricated using the same etc.
B. TiO2 nano ptcles - The ability to remove toxic substances using cases of TiO2’s function of removing toxic substances
i. Paper:
1. Formation of Antibacterial Film dried at Room Temperature using nano-sized T
2. Theoretical background
자유공간 또는 비자성체에서 정자계(steady magnetic field)의 기본적인 가정은 어떠한 자속흐름 원천은 있지 않으며 자속선은 항상 그들 자신에 대해 닫혀 있다는 것과, 전류가 흐르면 회전하는 자속이 생긴다는 것이다.
미분형
적분형
Table 1. 비자성 매질에서 정자계의 가
fields in China, India, the U.S. and worldwide
- Female workers account for 35% of Samsung Electronics’ total workforce in Korea
- Recruiting and Retaining Global Talent Fair Evaluation and Compensation
for Performance
2. Equal Opportunity and Non-discrimination Prohibition of Forced and Child Labor
3. Human Rights Education
- an annual mandatory course
field, our team decided to look through how it has been used so far and even now, and how effective it is for real.
.
Ⅱ. Theoretical research
Ⅱ-1. What is Ubiquitous computing?
Ubiquitous computing is a post-desktop model of human-computer interaction in which information processing has been thoroughly integrated into everyday objects and activities. In the course of ordinary activi
Materials
Accelerated electron : machine-generated accelerated electrons
Gamma-rays : cobalt 60, cesium 137
X-rays : machine-generated x-rays
Radiation dose : the quantity of radiation energy absorbed by the food
as it passes through the radiation field during processing.
Gray (Gy): one Gray equals one Joule of energy absorbed per
electromagnetic radiation을 발산하 게 된다. 이 resonance radiation의 발생과 감소를 기록함으로써 signal의 측정이 가능해지는 것이다. 물이나 기타 다른 물질 의 구성이 되는 수소원자는 좋은 공명체가 된다. 따라서 의학용으로 사용할때는 이 수소 원자를 사용한다. 1944년 소련의 물리학자인 Y. K. 자보이스키가
field)의 3요소가 있다. 이들 3요소는 시간과 장소에 따라 변화한다(그림 2, 3 참조). 서울부근에서 편각 ∼7°W, 복각은 53°N, 그리고 총세기는 약 52,000Υ가 된다. 지구 중심에 위치한 쌍극자의 연장선의 극점들은 지자기의 극(geomagnetic pole)이라고 부른다. 즉 지자기장은 쌍극자장과 일치하는 것이다. 이 점에
1. 인공지능(AI) 이란?
인공지능은 방식 상 학문의 전통적인 경계를 명백히 초월하기 때문에 인공지능의 기준이나 인공지능의 개념을 간단히 정의하는 것은 쉽지 않다. 인공지능에 관한 교과서라고 할 수 있는 Russell, S. & Norvig, P는 “인공지능은 큰 분야이고, 이 책은 큰 책이다(AI is a big field and this is a bi
sequence
NNTCAAGTTTTATGATTTATTTAACTTGTGGAACAAAAATAAACCAGATTAACCACAACCATGCCTTACTTTATCAAATGTATAAGANGTAAATATGAATCTTATATGACAAAATGTTTCATTCATTATAACAAATTTCCAATAATCCTGTCAATNATATTTCTAAATTTTCCCCCAAATTCTAAGCAGAGTATGTAAATTGGAAGTTAACTTATGCACGCTTAACTATCTTAACAAGCTTTGAGTGCAAGAGATTGANGAGTTCAAATCTGACCAAGATGTTGATGTTGGATAAGAGAATTCTCTGCTCCCCACCTCTANGTTGCCAGCCCTC
(Picture adapted from P. Cooper’s NCBI field guide)